[Boards: 3 / a / aco / adv / an / asp / b / biz / c / cgl / ck / cm / co / d / diy / e / fa / fit / g / gd / gif / h / hc / his / hm / hr / i / ic / int / jp / k / lgbt / lit / m / mlp / mu / n / news / o / out / p / po / pol / qa / qst / r / r9k / s / s4s / sci / soc / sp / t / tg / toy / trash / trv / tv / u / v / vg / vip /vp / vr / w / wg / wsg / wsr / x / y] [Home]
4chanarchives logo
Archived threads in /sci/ - Science & Math - 82. page
Images are sometimes not shown due to bandwidth/network issues. Refreshing the page usually helps.


File: 9780140289206.jpg (745 KB, 1677x2560) Image search: [iqdb] [SauceNao] [Google]
9780140289206.jpg
745 KB,
What am I in for, /sci/?
26 replies and 1 images submitted. Click here to view.
>>
Did you read that book?
>>
>>8461882
the best pop sci book ever written
>>
>>8461888
not yet

File: analysisexam.png (344 KB, 1200x2354) Image search: [iqdb] [SauceNao] [Google]
analysisexam.png
344 KB,
Hey /sci/
I have my exams in roughly 10 weeks and I basically didn't do anything all the time.
I made a strict plan for the next 10 weeks to master my exams as efficiently as possible.
The next 3 weeks starting now I'm going to devote to learning the basics of maths from all high school to uni (including first year).
During my high school time and even now I was pretty retarded regarding maths, I didn't catch the drift from the beginning and just let it slide. I still easily passed by compensating with other subjects so I never had to learn, so I could...
Comment too long. Click here to view the full text.
31 replies and 4 images submitted. Click here to view.
>>
>>8461642
I feel like I know all of these except 7. What's the embedded area of a curve?
>>
>>8461642
>basic math
this is not basic math
>>
>>8461642
You actually think you're going to be prepared for your pic-tier exam in three weeks time? topkekaroo

File: Royal-Institute-6.jpg (75 KB, 500x310) Image search: [iqdb] [SauceNao] [Google]
Royal-Institute-6.jpg
75 KB,
I'm on my way to the Royal Institution in London to see physicist professor Jim Al-Khalili in conversation with Ben Miller about astrobiology.

What question should I ask?
10 replies and 1 images submitted. Click here to view.
>>
Ask him wether he likes mudkipz.
>>
What does he think of /sci/?
>>
>>8461596
thats some prehistoric meme anon

limits are silly, all you're doing is guessing that a value is being approached given some arbitrary starting point. how can calculus be taken seriously like this? you think it's approaching h such that h is a value that's near x since you're basically just trying to cancel x with itself but don't want to get a division by zero situation. what a joke.
27 replies and 3 images submitted. Click here to view.
>>
>>8460573
It works. And if you don't think it works, have fun in mathematics without calculus.
>>
>>8460588
everyone for over a thousand years managed to use math just fine without asspulling "hurr look we're ALMOST here somewhere, ergo we are."

it's so ironic to hear people praise calculus for making a rigorous model that generalizes all the dozens of parlor trick methods for finding the volumes of saddle shapes or the acceleration of an object, yet it relies on the idea of "approaching" a value. at least with methods of exhaustion you know what values you approach but with this it's...
Comment too long. Click here to view the full text.
>>
>>8460593
>we're ALMOST here somewhere, ergo we are
it doesn't say that though. the function could have a hole at x, yet the limit as h approaches x can still exist.

File: 213r213sad.jpg (107 KB, 1000x500) Image search: [iqdb] [SauceNao] [Google]
213r213sad.jpg
107 KB,
What's your favorite sci-fi movie /sci/?
58 replies and 7 images submitted. Click here to view.
>>
Matrix Reloaded
>>
>>8458856

The Man From Earth, I think I've seen it like 15 times.
>>
The shining

File: tetetetetetete.webm (497 KB, 900x360) Image search: [iqdb] [SauceNao] [Google]
tetetetetetete.webm
497 KB,
How do we stop it?
45 replies and 15 images submitted. Click here to view.
>>
>>8458530
>Don't wanna close my eyes
>>
>>8458530
Obama's going to terraform mars soon so we can just go with Obama to mars
>>
>>8458530
>fly into space
>live in space
>possibly land on new planet

File: life52.gif (3 MB, 556x242) Image search: [iqdb] [SauceNao] [Google]
life52.gif
3 MB,
>mfw professor is doing partial derivatives on the board
>mfw he can't complete his own problem due to the difficulty of doing partial derivatives
>mfw I did the same problem in my head ans solved it in less than 2 minutes
why are brainlets allows to teach?
9 replies and 2 images submitted. Click here to view.
>>
Well OP when you go to a shitty school you should expect shitty profs.
>>
was this before or after you woke up?
>>
>>8464018
Because he has to solve it in real time in front of an entire class. Doing math in front of a group of people on the spot is choke city.

What's the best way to amplify DNA with high GC content? Here's the sequence.

5' GCACCGGGCAGGGACGTCCGGGAGGGC 3'

Also, I'm designing primers right now, and I know the standard is usually 18-22 bp. Given that this is so small, what do? I'm an undergraduate and I haven't had a lot of experience running PCR on oligos. Thanks.
6 replies and 2 images submitted. Click here to view.
>>
http://bitesizebio.com/24002/problems-amplifying-gc-rich-regions-problem-solved/
>>
>>8463934
Thanks mate. I actually just read this earlier. However, I have found very little information regarding the design of primers for a sequence so small. Any input would be immensely helpful.
>>
>I know the standard is usually 18-22 bp
in cases like this, fuck the standard

what matters is GC, Tm, and specificity. If you can find a shorter primer that has a reasonable GC content and Tm but is still specific to your sequence, there's no reason not to at least try it. Primers are cheap.

in this case though, what I'd do is just try to change up my project so I avoided that problem sequence. You'll waste more time trying to optimize this trouble primer and the PCR reaction than you would just tossing a little...
Comment too long. Click here to view the full text.

File: STEM.jpg (152 KB, 650x242) Image search: [iqdb] [SauceNao] [Google]
STEM.jpg
152 KB,
What're the most lucrative STEM professions within /sci/'s objective opinion?
31 replies and 3 images submitted. Click here to view.
>>
PetroE
Bachelors, $100k starting
>>
>>8463827
What about nuclear engineering or mathematics?
>>
>>8463827
lol, no. i go to the best Petro E school in the country and our placement rate is abysmally low. those 100k + starting salaries ended when oil tanked to 40$ a barrel.

File: 1455467346895.jpg (84 KB, 660x330) Image search: [iqdb] [SauceNao] [Google]
1455467346895.jpg
84 KB,
>problem requires unique ""trick"" that isn't obvious and could of only been known if you had prior knowledge of it
7 replies and 2 images submitted. Click here to view.
>>
>could of
>>
> requires unique ""trick""
how do you know its unique?
>>
>could of

brainlet confirmed

Sup nerds,

Why aren't you doing a double major in Math and Computational Theory, anon?

>Math enables you to think abstractly and understand eternal truths (I don't need to convince you guys why math is best tier)
>CS makes you employable, and by specializing in theory, you don't have to get a code monkey job.

How is this not the best STEM combination? I get to do this and graduate in 4 years at U of T(Math major + CS specialist with focus in Theory of computation)
8 replies and 4 images submitted. Click here to view.
>>
File: CS guide.png (178 KB, 1068x1142) Image search: [iqdb] [SauceNao] [Google]
CS guide.png
178 KB, 1068x1142
>>8463693
Because undergrad CS is a horrific waste of time. Just self study it.
>>
>>8463704

You could make a list like this for literally any program of study.

>Implying CS = programming
>>
File: CS.png (886 KB, 1170x500) Image search: [iqdb] [SauceNao] [Google]
CS.png
886 KB, 1170x500
>>8463822
>>Implying CS = programming
>Too stupid to read the image

CS is a joke

File: opposite1.jpg (1 KB, 200x197) Image search: [iqdb] [SauceNao] [Google]
opposite1.jpg
1 KB,
Why do we have minus numbers?
33 replies and 2 images submitted. Click here to view.
>>
Because closure is a useful property.
>>
I like to think of the number line like a time line, minus is past, 0 is present and regular numbers are the future. The past goes on and it obviously exists. Also there is the concept of debt. You can owe someone cash but you wouldn't say I have 0 dollars when in debt, you would say I have negative x dollars. As soon as you get x amount you have 0 dollars, where as if you begin with 0 dollars and receive x amount...you have x amount of dollars.
>>
>>8462502
You owe me ten dollars and at this moment you are broke.

You have -10 dollars in your account.

File: 1475596325576645862.jpg (64 KB, 438x267) Image search: [iqdb] [SauceNao] [Google]
1475596325576645862.jpg
64 KB,
>real analysis class
>Prof uses things that weren't yet thoroughly defined "because you should know that from school"
>He fails you if you use some things and theorems from school "because we didn't define them yet"
36 replies and 2 images submitted. Click here to view.
>>
This is a complaint for your school's math department, not /sci/
>>
>>8462458
Maybe you just suck at determining what is trivial and what is you being a lazy fuck
>>
>>8462458
Cite what theorem you're using, don't just use a result implicitly in your proof.

File: PqD9V8km_400x400.png (313 KB, 400x400) Image search: [iqdb] [SauceNao] [Google]
PqD9V8km_400x400.png
313 KB,
In the end, is the net effect of popscience actually damaging or helping (real) science?
31 replies and 3 images submitted. Click here to view.
>>
Damaging. Needs more math. Normies think science is shit you discuss between bong hits.
>>
>>8461609
>>
>>8461604
Helping. A lot of redditors think they 'just totally get it, man' and go study math or physics to then only pay the big bucks a couple of the first semestees (the ones that are cheapest for the uni to keep but cost just as much as the future semesters for the students) and give money to our programs and then they just leave, giving our departments huge profit margins that they can use to fund us.

At my uni the stop students get paid a monthly salary funded right from brainlet pockets.

File: bookshelf.jpg (1 MB, 6000x5312) Image search: [iqdb] [SauceNao] [Google]
bookshelf.jpg
1 MB,
Show us your place of knowledge
59 replies and 12 images submitted. Click here to view.
>>
wow! you must be really smart
>>
File: library.png (529 KB, 640x1136) Image search: [iqdb] [SauceNao] [Google]
library.png
529 KB, 640x1136
>>8458921
Here is my bookshelf you fucking faggot.

You are either really old or really stupid lol. Not only are your books infinitely more expensive than mine, they take more space and will cause you trouble sometime in the future when you need to move or have to re-order to accomodate for more useful furniture.

>The "real books" industry still going strong in 2016 selling only to retards.

I wonder if only retards buy books, or if buying books makes you a retard.

What...
Comment too long. Click here to view the full text.
>>
>>8458953
Books are an aesthetic element in a room, faggot.

Also, take your pedophile calculus book to >>>/a/.

File: 1454383018502.jpg (70 KB, 500x600) Image search: [iqdb] [SauceNao] [Google]
1454383018502.jpg
70 KB,
Hey /sci/, In my university my professors have been telling me that there is no biological difference in races and that it's a cultural difference. They tell me that science has proved this and that there is no genetic difference between races. This is obviously retarded, and I was wondering if there were any studies you could point me towards that disproves this theory. I've recently seen on /his/ discussions on different genes that show a person's ethnicity. I vaguely remember seeing them labeled as one letter and then two numbers to specify. I know this may...
Comment too long. Click here to view the full text.
78 replies and 6 images submitted. Click here to view.
>>
>>8457938

if you look in genetics studies youll find that the truth is somewhere in the middle. ofcourse there is variation between people across geographical space but there is no scientific way to divide these into non-arbitrary racial groups.
>>
>>8457938

https://scholar.google.co.uk/scholar?q=race+human+diversity+genetics&btnG=&hl=en&as_sdt=0%2C5

this search will probably have studies you will want to look for, using an unbiased search
>>
>>8457938

i dont think theres any genes that show a persons ethnicity. it wouldnt make sense.

File: ice cubes.jpg (11 KB, 300x260) Image search: [iqdb] [SauceNao] [Google]
ice cubes.jpg
11 KB,
So my apartment water is shut off for a few hours. I'm thirsty and don't have anything to drink, but, I have two ice cube trays. Can I microwave ice cubes? I've heard they can explode in a microwave but idk if that's true...
14 replies and 1 images submitted. Click here to view.
>>
>>8463457
Yea sure, why not just also place them onto a metal pot and heat that with a stove-top burner, like one would normally boil water?
>>
>>8463459
unfortunately I only have one pot and it's dirty. And I can't clean it because no water to clean with :(
>>
>put ice cubes in a clean glass
>put glass on top of or near a heat source (body, PC, heater, lamp)
>drinkable cold water

File: 1473228225631.jpg (186 KB, 319x776) Image search: [iqdb] [SauceNao] [Google]
1473228225631.jpg
186 KB,
I finished learning high school maths. Now I want to learn some basic set theory. Is there a good book for this level that also has solutions to the exercises/proofs?
7 replies and 2 images submitted. Click here to view.
>>
>>8463345
short reviews across a wide variety of topics, a few deal with set theory
https://www.ocf.berkeley.edu/~abhishek/chicmath.htm

the above link may not provide you with what you are looking for right now, still worth looking at

best of luck
>>
>>8463345
What material did you use to learn the high school math? I don't study formally right now because wife is in college but I've been looking for good resources to relearn middle and high school math, and maybe science.

Good luck on your search.
>>
>>8463354
Thanks!

Is there a name for this "trick" or more general method to know that the product of the numerators is that cubic difference? Other than simply multiplying through and cancelling.
I'm pretty sure someone explained to me a way to know it.
7 replies and 1 images submitted. Click here to view.
>>
>>8463308
Use (a + b)^n =(n choose k)a^kb^(n-k)
>>
>>8463311
Not sure I see it. Wouldn't it need to be 2ab for binomial theorem?
>>
>>8463308
I'd stick with multiplying

File: frog.jpg (8 KB, 251x242) Image search: [iqdb] [SauceNao] [Google]
frog.jpg
8 KB,
>"""""law""""" of large numbers
8 replies and 1 images submitted. Click here to view.
>>
>it's actually a theorem.
>>
>define """""large"""""
>>
>>8463298
Isn't it technically "the sum of a large number of uniform random variables will tend toward a normal random distribution"?

File: Capture.png (276 KB, 692x794) Image search: [iqdb] [SauceNao] [Google]
Capture.png
276 KB,
Have you done a test like this? Do you think choosing a candidate in this manner is more in line with the scientific method?

I imagine if we replaced the current election system with something like this, people would be less blinded by the rhetorics and charisma of a candidate (or lack thereof), which causes people to vote with their feelings instead of rationally.

Also I dont intend to argue about wether or not I ticked the right boxes, to keep this from becoming too /pol/.
6 replies and 1 images submitted. Click here to view.
>>
>>8463271
it unfortunately doesn't matter as long as there's first past the post voting.

Also I think there is a bias you have to worry about
>>
>>8463271
I did some months ago. I remember that I sided as much with Trump as I did with Hillary and Bernie was the guy I sided with the most.

That felt sad. The media would give you the impression that Trump is the anti Hillary and Hillary is the anti trump but aside from a couple meme issues like 'muh wiimmenzz' they are pretty much equivalent.

Proof of how the supposed left is just the center right. Democrats are just republicans who care a little more about personal rights and thus support stuff...
Comment too long. Click here to view the full text.
>>
>>8463274
What bias do you mean? The one from the site or from me kind of not wanting to align with Hillary?

And what do you think about the idea to replace elections with a test like this, and candidates with ideas?

File: IMG_1680.jpg (133 KB, 960x723) Image search: [iqdb] [SauceNao] [Google]
IMG_1680.jpg
133 KB,
I tried to bleach my hair blonde. I left it on for 50 minutes, and it was a clear color so I couldn't tell that a chunk landed on my skin. Now the actual hair is an ugly brassy color, but obviously I'm afraid to put any more chemical (toner) on my hair because I don't wanna make the blistering worse.

What can I do? Also; will it leave scarring? It hurts pretty bad. It's been 5 hours. There was a bubble at first that went away.

Any advice, thanks.
9 replies and 3 images submitted. Click here to view.
>>
File: IMG_1657.jpg (255 KB, 2075x1077) Image search: [iqdb] [SauceNao] [Google]
IMG_1657.jpg
255 KB, 2075x1077
Fivehead; I guess from a distance it doesn't look horrible.
>>
still kind of deep. flash with cold water to neutralize ph balance. don't put anything on it in case of mixing with the bleach.

then is up to vitamins and exercise to push the skin cells up,flake off the old ones, and get rid of the scar.
>>
File: 1453418842876.png (186 KB, 600x600) Image search: [iqdb] [SauceNao] [Google]
1453418842876.png
186 KB, 600x600
>>8462981


-poor cold water on it
-neutralize with solution with basic ph, like baking soda in water
-put creams for burns, like pic
-put cream/ointment to moisturize, like hydromol or some biafine
-when going out, put sun screen, like spf 50

File: 1448162904513.jpg (393 KB, 1280x960) Image search: [iqdb] [SauceNao] [Google]
1448162904513.jpg
393 KB,
At what age do people usually get their PhD?

>pic unrelated
7 replies and 2 images submitted. Click here to view.
>>
>>8462947
depends on the field blah blah blah
supposing 5 years in as a graduate student:
26 or 27 years old
>>
File: 1472373782495.png (1 MB, 844x1221) Image search: [iqdb] [SauceNao] [Google]
1472373782495.png
1 MB, 844x1221
>>8463159
>in as
derp

*supposing 5 years as a graduate student
>>
>>8463159
Some people work then come back around that age. It isn't unheard of

If you have an electric circuit with a 12V battery in series with an open switch and a resistor, the voltage drop across the open switch is 12V. But this doesn't quite make sense to me. If there is no current, why does Ohm's Law not apply giving me a voltage drop of V = IR = 0 as there is no current?
11 replies and 3 images submitted. Click here to view.
>>
open switch is a resistor with an Ohm value of infinity
>>
>>8462388
Not OP but multiplied by zero what is that? I suspect it is because mathematics is not a real science but an entirely man made construct. Electrical engineering should probably isolated from such things.
>>
I don't know. I dropped out of Intro to Electrial Engineering.

File: ex-machina-1.jpg (28 KB, 620x349) Image search: [iqdb] [SauceNao] [Google]
ex-machina-1.jpg
28 KB,
How does it feel knowing that mathematics professions will be obsolete in the next 50 years thanks to incredibly intelligent, sentient AI being able to calculate what your monkeybrain can't?
10 replies and 1 images submitted. Click here to view.
>>
Almost every profession will eventually be obsolete if hard AI becomes real.
>>
>>8462161
>if
>>
who will teach the AI to do these calculations OP?

File: science!.jpg (252 KB, 1440x900) Image search: [iqdb] [SauceNao] [Google]
science!.jpg
252 KB,
http://www.sciencealert.com/leaked-nasa-paper-shows-the-impossible-em-drive-really-does-work

Meme drive really works
8 replies and 2 images submitted. Click here to view.
>>
>>8461507
So we're all in agreement that the Roswell UFO had one of these on it and that's why microwave ovens came out right around that time but we're only now figuring out how the original drive worked, right?
>>
>>8461507
Fucking memedrive.
>>
>>8461518
My microwave broke the day this came out. Clearly it's a sign.

Post them nerds
315 replies and 102 images submitted. Click here to view.
>>
This ones not quite humor but it is cool
>>
>>

File: 1449894599628.jpg (908 KB, 1215x1494) Image search: [iqdb] [SauceNao] [Google]
1449894599628.jpg
908 KB,
Study and note-taking thread.
How do you like taking your notes?
What is working for you when you're studying?
18 replies and 6 images submitted. Click here to view.
>>
>>8462961
>Not reading the full text again when revising
Brainlet detected
>>
File: 1478384612888.jpg (60 KB, 878x814) Image search: [iqdb] [SauceNao] [Google]
1478384612888.jpg
60 KB, 878x814
>>8462961
This is full fucking sperg.

WHO WRITES THEIR UNIT PREREQUISITES IN THEIR NOTES?

99% chance you wont look at them again anyway..

Taking notes like this is an brainlet abomination
>>
>>8462961
what do the numbers for hours mean?

File: ElectronSpinUpDown.gif (267 KB, 756x567) Image search: [iqdb] [SauceNao] [Google]
ElectronSpinUpDown.gif
267 KB,
am i allowed to make my phd thesis in the form of an animated film?
13 replies and 5 images submitted. Click here to view.
>>
>>8462921
go ask your professor
>>
You certainly can.

Have fun with your defense, though.
>>
>>8462921
as an advisor from your department, I'm going to say yes

oh wait, i'm not an advisor from your department, i'm a random person on 4chan, why are you asking me?

When you attended primary school, did they at any point explain what logic is? I mean, I was taught math but never thought of logic as the tool that makes it all work until recently.
14 replies and 1 images submitted. Click here to view.
>>
why do you think logic makes math work?
>>
>>8462639
Logic is what makes math work?

1+1=2

The logic is the " +" and the "=" without that it wouldn't be a math problem, all math is material and logic is a medium to present it on.
>>
>>8462672
those are symbols and rules. where is the logic required in that?


Pages: [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47] [48] [49] [50] [51] [52] [53] [54] [55] [56] [57] [58] [59] [60] [61] [62] [63] [64] [65] [66] [67] [68] [69] [70] [71] [72] [73] [74] [75] [76] [77] [78] [79] [80] [81] [82] [83] [84] [85] [86] [87] [88] [89] [90] [91] [92] [93] [94] [95] [96] [97] [98] [99] [100] [101] [102] [103] [104] [105] [106] [107] [108] [109] [110] [111] [112] [113] [114] [115] [116] [117] [118] [119] [120] [121] [122] [123] [124] [125] [126] [127] [128] [129] [130] [131] [132] [133] [134] [135] [136] [137] [138] [139] [140] [141] [142] [143] [144] [145] [146] [147] [148] [149] [150] [151] [152] [153] [154] [155] [156] [157] [158] [159] [160] [161] [162] [163] [164] [165] [166] [167] [168] [169] [170] [171] [172] [173] [174] [175] [176] [177] [178] [179] [180] [181] [182] [183] [184] [185] [186] [187] [188] [189] [190] [191] [192] [193] [194] [195] [196] [197] [198] [199] [200] [201] [202] [203] [204] [205] [206] [207] [208] [209] [210] [211] [212] [213] [214] [215] [216] [217] [218] [219] [220] [221] [222] [223] [224] [225] [226] [227] [228] [229] [230] [231] [232] [233] [234] [235] [236] [237] [238] [239] [240] [241] [242] [243] [244] [245] [246] [247] [248] [249] [250] [251] [252] [253] [254] [255] [256] [257] [258] [259] [260] [261] [262] [263] [264] [265] [266] [267] [268] [269] [270] [271] [272] [273] [274] [275] [276] [277] [278] [279] [280] [281] [282] [283] [284] [285] [286] [287] [288] [289] [290] [291] [292] [293] [294] [295] [296] [297] [298] [299] [300] [301] [302] [303] [304] [305] [306] [307] [308] [309] [310] [311] [312] [313] [314] [315] [316] [317] [318] [319] [320] [321] [322] [323] [324] [325] [326] [327] [328] [329] [330] [331] [332] [333] [334] [335] [336] [337] [338] [339] [340] [341] [342] [343] [344] [345] [346] [347] [348] [349] [350] [351] [352] [353] [354] [355] [356] [357] [358] [359] [360] [361] [362] [363] [364] [365] [366] [367] [368] [369] [370] [371] [372] [373] [374] [375] [376] [377] [378] [379] [380] [381] [382] [383] [384] [385] [386] [387] [388] [389] [390] [391] [392] [393] [394] [395] [396] [397] [398] [399] [400] [401] [402] [403] [404] [405] [406] [407] [408] [409] [410] [411] [412] [413] [414] [415] [416] [417] [418] [419] [420] [421] [422] [423] [424] [425] [426] [427] [428] [429] [430] [431] [432] [433] [434] [435] [436] [437] [438] [439] [440] [441] [442] [443] [444] [445] [446] [447] [448] [449] [450] [451] [452] [453] [454] [455] [456] [457] [458] [459] [460] [461] [462] [463] [464] [465] [466] [467] [468] [469] [470] [471] [472] [473] [474] [475] [476] [477] [478] [479] [480] [481] [482] [483] [484] [485] [486] [487] [488] [489] [490] [491] [492] [493] [494] [495] [496] [497] [498] [499] [500] [501] [502] [503] [504] [505] [506] [507] [508] [509] [510] [511] [512] [513] [514] [515] [516] [517] [518] [519] [520] [521] [522] [523] [524] [525] [526] [527] [528] [529] [530] [531] [532] [533] [534] [535] [536] [537] [538] [539] [540] [541] [542] [543] [544] [545] [546] [547] [548] [549] [550] [551] [552] [553] [554] [555] [556] [557] [558] [559]
Pages: [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47] [48] [49] [50] [51] [52] [53] [54] [55] [56] [57] [58] [59] [60] [61] [62] [63] [64] [65] [66] [67] [68] [69] [70] [71] [72] [73] [74] [75] [76] [77] [78] [79] [80] [81] [82] [83] [84] [85] [86] [87] [88] [89] [90] [91] [92] [93] [94] [95] [96] [97] [98] [99] [100] [101] [102] [103] [104] [105] [106] [107] [108] [109] [110] [111] [112] [113] [114] [115] [116] [117] [118] [119] [120] [121] [122] [123] [124] [125] [126] [127] [128] [129] [130] [131] [132] [133] [134] [135] [136] [137] [138] [139] [140] [141] [142] [143] [144] [145] [146] [147] [148] [149] [150] [151] [152] [153] [154] [155] [156] [157] [158] [159] [160] [161] [162] [163] [164] [165] [166] [167] [168] [169] [170] [171] [172] [173] [174] [175] [176] [177] [178] [179] [180] [181] [182] [183] [184] [185] [186] [187] [188] [189] [190] [191] [192] [193] [194] [195] [196] [197] [198] [199] [200] [201] [202] [203] [204] [205] [206] [207] [208] [209] [210] [211] [212] [213] [214] [215] [216] [217] [218] [219] [220] [221] [222] [223] [224] [225] [226] [227] [228] [229] [230] [231] [232] [233] [234] [235] [236] [237] [238] [239] [240] [241] [242] [243] [244] [245] [246] [247] [248] [249] [250] [251] [252] [253] [254] [255] [256] [257] [258] [259] [260] [261] [262] [263] [264] [265] [266] [267] [268] [269] [270] [271] [272] [273] [274] [275] [276] [277] [278] [279] [280] [281] [282] [283] [284] [285] [286] [287] [288] [289] [290] [291] [292] [293] [294] [295] [296] [297] [298] [299] [300] [301] [302] [303] [304] [305] [306] [307] [308] [309] [310] [311] [312] [313] [314] [315] [316] [317] [318] [319] [320] [321] [322] [323] [324] [325] [326] [327] [328] [329] [330] [331] [332] [333] [334] [335] [336] [337] [338] [339] [340] [341] [342] [343] [344] [345] [346] [347] [348] [349] [350] [351] [352] [353] [354] [355] [356] [357] [358] [359] [360] [361] [362] [363] [364] [365] [366] [367] [368] [369] [370] [371] [372] [373] [374] [375] [376] [377] [378] [379] [380] [381] [382] [383] [384] [385] [386] [387] [388] [389] [390] [391] [392] [393] [394] [395] [396] [397] [398] [399] [400] [401] [402] [403] [404] [405] [406] [407] [408] [409] [410] [411] [412] [413] [414] [415] [416] [417] [418] [419] [420] [421] [422] [423] [424] [425] [426] [427] [428] [429] [430] [431] [432] [433] [434] [435] [436] [437] [438] [439] [440] [441] [442] [443] [444] [445] [446] [447] [448] [449] [450] [451] [452] [453] [454] [455] [456] [457] [458] [459] [460] [461] [462] [463] [464] [465] [466] [467] [468] [469] [470] [471] [472] [473] [474] [475] [476] [477] [478] [479] [480] [481] [482] [483] [484] [485] [486] [487] [488] [489] [490] [491] [492] [493] [494] [495] [496] [497] [498] [499] [500] [501] [502] [503] [504] [505] [506] [507] [508] [509] [510] [511] [512] [513] [514] [515] [516] [517] [518] [519] [520] [521] [522] [523] [524] [525] [526] [527] [528] [529] [530] [531] [532] [533] [534] [535] [536] [537] [538] [539] [540] [541] [542] [543] [544] [545] [546] [547] [548] [549] [550] [551] [552] [553] [554] [555] [556] [557] [558] [559]

[Boards: 3 / a / aco / adv / an / asp / b / biz / c / cgl / ck / cm / co / d / diy / e / fa / fit / g / gd / gif / h / hc / his / hm / hr / i / ic / int / jp / k / lgbt / lit / m / mlp / mu / n / news / o / out / p / po / pol / qa / qst / r / r9k / s / s4s / sci / soc / sp / t / tg / toy / trash / trv / tv / u / v / vg / vip /vp / vr / w / wg / wsg / wsr / x / y] [Home]
[Boards: 3 / a / aco / adv / an / asp / b / biz / c / cgl / ck / cm / co / d / diy / e / fa / fit / g / gd / gif / h / hc / his / hm / hr / i / ic / int / jp / k / lgbt / lit / m / mlp / mu / n / news / o / out / p / po / pol / qa / qst / r / r9k / s / s4s / sci / soc / sp / t / tg / toy / trash / trv / tv / u / v / vg / vip /vp / vr / w / wg / wsg / wsr / x / y] [Home]

All trademarks and copyrights on this page are owned by their respective parties. Images uploaded are the responsibility of the Poster. Comments are owned by the Poster.
This is a 4chan archive - all of the content originated from them. If you need IP information for a Poster - you need to contact them. This website shows only archived content.
If a post contains personal/copyrighted/illegal content you can contact me at wtabusse@gmail.com with that post and thread number and it will be removed as soon as possible.